OUP user menu

Expansion of a Clonal CD8+CD57+ Large Granular Lymphocyte Population After Autologous Stem Cell Transplant in Multiple Myeloma

Kristy L. Wolniak MDPhD, Charles L. Goolsby PhD, Yi-Hua Chen MD, Anjen Chenn MDPhD, Seema Singhal MD, Jayesh Mehta MD, LoAnn C. Peterson MD
DOI: http://dx.doi.org/10.1309/AJCP1T0JPBLSLAQF 231-241 First published online: 1 February 2013

Abstract

Clonal expansions of large granular lymphocytes (LGLs) have been identified in patients following stem cell transplants and may represent posttransplant LGL leukemias or reactive immune responses. To differentiate between these 2 possibilities, we assessed peripheral blood and bone marrow of patients with myeloma after autologous stem cell transplant. All patients examined shortly after autologous stem cell transplant had significant increases in the LGLs in the peripheral blood and bone marrow (71% of lymphocytes) as compared with controls (39%). This increase was detectable years after transplant. The LGLs had a reproducible immunophenotype of CD8+CD57+ T cells without phenotypic abnormalities in 19 of 20 patients. Sixty-five percent of the post-autologous stem cell transplant patients had clonal T-cell receptor gene rearrangements in the bone marrow, yet no patients had neutropenia or splenomegaly. Although the LGL expansions were clonal and persistent, the lack of clinical sequelae suggests the clonal LGL expansion is a reactive, potentially beneficial, immune response to autologous stem cell transplant.

Key Words
  • Hematopathology
  • Flow cytometry
  • Autologous stem cell transplant
  • Cytotoxic T cells
  • Myeloma

Prior studies have reported a persistent large granular lymphocytosis following allogeneic stem cell13 and solid organ transplants.4 These studies demonstrated persistence of cytotoxic effector T-cell expansions in multiple patients following transplant (3% of stem cell transplants3 and 44%– 71% of solid organ transplants4), with evidence of clonal ity in some cases. In these allogeneic transplant patients, the driving force of the large granular lymphocyte (LGL) expansion was thought to be foreign antigen exposure from the grafts. Interestingly, an increased proportion of LGLs has also been reported in peripheral blood following autologous stem cell transplant,58 in which the allogeneic foreign antigen is not present. In 2 cases following autologous stem cell transplant, T-cell LGL leukemia was reported, and the LGL expansion was considered a posttransplant lymphoproliferative malignancy,5,8 whereas in 1 case the expansion was considered a reactive process against the patient’s tumor cells.7

The implications of a neoplastic expansion vs a reactive, and potentially beneficial, expansion of LGLs following autologous transplant are strikingly different, yet it can be problematic to differentiate between the two. Because autologous stem cell transplant following high-dose chemotherapy is a mainstay of therapy for myeloma,9,10 we systematically evaluated LGL expansion in the peripheral blood and bone marrow following autologous stem cell transplant in a group of patients with myeloma. We sought to clearly define the expansion of LGLs and gain insight into the clinical implications of these expansions in the posttransplant setting. Flow cytometric immunophenotyping was performed on bone marrow aspirates to determine the extent of expansion of this population in the bone marrow. In addition, molecular studies were performed on the bone marrow aspirates to evaluate for T-cell receptor clonality. This study takes a multifaceted and comprehensive approach to identify and track the large granular lymphocytosis in myeloma patients undergoing autologous stem cell transplant.

Materials and Methods

Patient Selection

This study was approved by the Northwestern University Internal Review Board (Chicago, IL). Fifty-two patients were selected based on submission of bone marrow aspirates for flow cytometric immunophenotyping at the Northwestern Memorial Hospital flow cytometry clinical facility as part of myeloma evaluation. Patients were divided into the following groups: plasma cell myeloma with recent autologous stem cell transplant (45–90 days), plasma cell myeloma with prior autologous stem cell transplant (6 months to 4 years), new diagnosis of plasma cell myeloma without treatment, previously diagnosed plasma cell myeloma with therapy but no autologous stem cell transplant, and monoclonal gammopathy of undetermined significance (MGUS). Bone marrow samples undergoing flow cytometric immunophenotypic analysis at Northwestern Memorial Hospital as part of a pretreatment lymphoma staging without disease involvement in the bone marrow and bone marrow derived from orthopedic samples served as control samples.

Patient Medical Record Evaluation

Medical records were reviewed from the 52 patients. Pathologic data, including morphologic assessment results, flow cytometric immunophenotypic analyses, and genetic analyses, were evaluated. In addition, clinical data were collected on the patients, including disease stage, engraftment, infectious complications, date of plasma cell myeloma or MGUS diagnosis, International Prognostic Scoring System score, therapy, date of stem cell transplant, hemoglobin, neutrophil count, serum and urine protein levels, and clinical response to transplant.

Flow Cytometric Immunophenotyping

To assess frequency and immunophenotype of the LGLs in the bone marrow, we performed 6-color flow cytometric analysis on 52 bone marrow aspirates sent for myeloma evaluation and 8 controls. Data collection was performed on a Becton Dickinson Biosciences (BD, Franklin Lakes, NJ) LSR II flow cytometer employing 488 nm and 635 nm excitation and using 505-nm longpass (LP), 550-nm dichroic LP (DCLP), 530-nm bandpass (BP), 575-nm BP, 685-nm DCLP, 695-nm BP, 735-nm DCLP, and 780-nm BP for the 488-nm excitation source and 735-nm DCLP, 660-nm BP, and 780- nm BP for the 635-nm excitation source. Data analysis was performed using FACSDiva software (BD). The following antigens were assessed to characterize the cells and evaluate for patterns of abnormal T-cell antigen expression: CD3 PerCP-Cy5.5 (BD, clone SK7), CD8 APC-H7 (BD, clone SKI), CD57 FITC (Beckman Coulter [Indianapolis, IN], clone NCI), CD56 PE-Cy7 (Beckman Coulter, clone NKH-1), TIA-1 PE (Beckman Coulter, clone 2G9A10F5), granzyme B FITC (BD, clone GB11), CD 16 PE (BD, clone B73.1), and CD5 APC (BD, clone L17F12). In addition, to assess for a restricted population of cells, we analyzed a subset of the killing inhibitor receptor (KIR) antigens by the following KIR antibodies: CD 158a APC (Beckman Coulter, clone EB6B), CD 158b FITC (BD, clone CH-L), and CD158e PE (Beckman Coulter, clone Z27.3.7). Plasma cells were assessed by CD38 APC (BD, clone HB7) and CD138 PerCP-Cy5.5 (BD, clone MI15).

The percentage of CD3+ T cells was determined as percent CD3+ cells of total cellular events and as a percentage of total lymphocytes. The percentage of CD3+CD8+ was determined as a percentage of lymphocytes and a percentage of CD3+ T lymphocytes in the bone marrow aspirate. Positive and negative expression of immunophenotypic markers was determined based on comparison and degree of overlap as compared with multiple nonreactive populations of cells. Relative expansion of the CD8+ population was defined as an increase in the percentage of CD8+ cells out of CD3+ cells as compared with controls.

Molecular Analyses

Molecular analyses of the T-cell receptor (TCR) gene were performed to assess for clonality of the T-cell populations using the Invivoscribe TCRγ T-cell clonality assay (Invivoscribe Technologies, San Diego, CA) and capillary electrophoresis (ABI 3130-I; Applied Biosystems, Carlsbad, CA). The primer sets target regions of conserved DNA sequences in the V and J regions on either side of the TCRγ hypervariable region. Two tubes of primer sets were analyzed for each patient. The primers were as designed by the manufacturer: GGAAGGCCCCACAGCTTCTT, AGCATGGG TAAGACAAGGAA, CGAGTATCATTGAAGCGGAC CATT, and GAGAAACCGTCACCTTGTTGTG in tube A and CGCCACTGTCAGAAAGGAATC, CTTCCACTTC CACTTTGAAA, CGAGTATCATTGAAGCGGACCATT, and GAGAAACCGTCACCTTGTTGTG in tube B. In a clonal T-cell population, all the cells produce the same TCRγ, so the polymerase chain reaction (PCR) products will be of the same size, producing a narrow spike on capillary electrophoresis. A population is considered clonal if the height of the spike is more than 3 times the height of the third highest peak in a given range of DNA sizes.

Statistics

To assess for an expansion in the population of CD8+ cytotoxic T cells within post-autologous transplant myeloma patients, we averaged the percentage of CD8+ cells as a proportion of CD3+ T cells within each patient group. SPSS statistical software, version 15 (SPSS, Chicago, IL) was used to perform an F test to determine if there was a significant difference between the mean value of CD8+ cells as a proportion of T cells between the post-autologous stem cell transplant myeloma patients and control patients. A 1-way analysis of variance (ANOVA) F test was used to compare the means of the populations. In addition, to determine if the antigen expression within the CD8+ population differed significantly between the populations, the percentage of CD57+ cells out of CD8+ cells was compared between the different groups. Student t test was also performed to compare populations in Figure 1 and Figure 2.

Figure 1

Manual cell counting of the lymphocytes in the peripheral blood smears is presented as (A) absolute number of large granular lymphocytes (LGLs) and (B) percent LGLs out of total lymphocytes. The specimens obtained in myeloma patients 45 to 90 days after autologous stem cell transplant are compared with myeloma patients who have not had stem cell transplants. All intact lymphocytes on the peripheral blood smears were counted. To determine the overall absolute LGL count (A), the percent LGL was multiplied by the percent lymphocytes from a manual differential. The white blood count at the time of the sample collection was multiplied by this percentage to obtain the absolute number of LGLs. The error bars represent standard deviation.

Figure 2

FIow cytometric immunophenotyping identifies an expanded population of CD8+CD57+ T cells. Flow cytometric immunophenotyping for large granular lymphocytes was performed on bone marrow aspirates from 20 post-autologous stem cell transplant myeloma patients and controls. A, Representative dot plots of lymphocyte-gated cells (based on forward and side scatter) and CD3+ gated cells (red) in 1 myeloma patient before and after autologous stem cell transplant demonstrate the increase in proportion of CD8+ cells (blue). Univariate histograms of lymphocyte and CD3+ gated cells also demonstrate the relative increase in CD8+ cells. Representative dot plots of lymphocytes and histograms of CD3+ and CD8+ gated cells in the same patient demonstrate an increase in the CD57+ cells after autologous stem cell transplant. The percent CD8+ cells out of CD3+-gated cells (B) and the percent of CD8+ cells that are CD57+ (C) were assessed by flow cytometric immunophenotyping in the controls, newly diagnosed myeloma patients, myeloma patients without transplants, and myeloma patients 45 to 90 days after autologous transplants. The control bone marrow specimens were obtained from patients without bone marrow disease and without cytopenias. The error bars represent standard deviation. For myeloma patients 45 to 90 days after transplant as compared with controls, *P<.001.

Results

LGL Population Is Expanded in Peripheral Blood Following Autologous Stem Cell Transplant

To quantify and characterize the expansion of the LGLs in myeloma patients after autologous stem cell transplant, we evaluated peripheral blood and bone marrow samples from 20 myeloma patients 45 to 90 days after autologous stem cell transplant. We also examined samples from 9 patients with established myeloma receiving therapy but without transplant, 9 patients with newly diagnosed myeloma, 7 patients with MGUS, and 8 control patients without plasma cell neoplasms. LGLs increased in both the bone marrow aspirate smears and peripheral blood smears in patient samples following autologous stem cell transplant as compared with patients who had not had a stem cell transplant Image 1A and Image 1B. The LGLs showed no morphologic atypia (Image 1). Manual cell counting coupled with white blood cell analysis of the peripheral blood smears demonstrated a relative and absolute increase in the number of LGLs in the peripheral blood of myeloma patients after autologous stem cell transplant as compared with myeloma patients without transplant (Figure 1). Forty-five to 90 days after autologous stem cell transplant, myeloma patients had an average LGL count of 590/ μL (range, 164-3,225/μL) as compared with 195/μL (range, 50-340/μL) in myeloma patients without transplant. The LGL count in the myeloma patients without transplant was within the normal reported reference range (mean ± SD, 223 ± 99/μL).11 LGLs averaged 38% (range, 19%–73%) of the lymphocytes in the peripheral blood of the transplant patients and 12% (range, 3%–15%) of the lymphocytes in myeloma patients without transplant.

Image 1

There is an expansion of large granular lymphocytes in the peripheral blood and bone marrow following autologous stem cell transplantation in myeloma patients. Representative images are taken from the bone marrow and peripheral blood samples of a myeloma patient 2 months after autologous stem cell transplant. Large granular lymphocytes are identified in (A) the Wright-Giemsa-stained bone marrow aspirate smear and (B) peripheral blood smear. (C) ×20 and (D) ×40 images (Olympus [Center Valley, PA] DP71 camera) of the H&E-stained bone marrow core biopsy specimen demonstrate normal trilineage hematopoiesis without abnormal lymphoid infiltrate.

Flow Cytometric Evaluation Identifies an Expanded Population of CD8+C57+ Cytotoxic T Cells

To evaluate and identify the expansion of the population of LGLs in the bone marrow, we performed flow cytometric immunophenotyping of LGLs in the bone marrow aspirates. Figure 2A shows the histogram of the CD3+-gated T-cell population in 1 representative myeloma patient before and shortly after autologous stem cell transplant. There is a clear increase in the proportion of CD8+ cells within the T-cell population, as well as an increase in the expression of CD57 within the CD8+ T-cell population following transplant. This pattern of increased CD8+ and CD57+ cells was seen in all posttransplant myeloma patients. Flow cytometric relative quantification of the CD8+ cells in the cases identified that the percentage of CD8+ cells out of the CD3+ T cells significantly increased in the transplant patients (71%) as compared with the control patients (39%), newly diagnosed myeloma patients (32%), and myeloma patients without transplant (38%) (Figures 2B and 2C). Within the CD8+ population, the proportion of CD57+ cells also significantly increased in the transplant patients (39%) as compared with the controls (18%) but did not significantly increase over newly diagnosed myeloma patients or myeloma patients without transplant (Figures 2B and 2C). These findings identify the expanded population of LGLs as CD8+CD57+ cytotoxic T cells.

To further characterize the expanded LGLs and to evaluate for overt phenotypic T-cell abnormalities, we evaluated each bone marrow aspirate with a panel of T-cell-specific antibodies against CD3, CD5, CD8, CD57, CD56, CD 16, TIA-1, and granzyme B. Interestingly, the expanded population of CD8+ cells had the same immunophenotype in all post-autologous stem cell transplant patients except 1. The phenotype was CD5+, CD8+, partial CD57+, dim to negative CD56, CD16-, and TIA-1+ Figure 3. Although they expressed TIA-1, the CD8+ cells were negative for granzyme B. Each case was assessed for overt T-cell abnormalities such as antigen loss. In 19 patients, there was no alteration in T-cell surface markers, but in 1 patient, there was a loss of CD5 expression.

Figure 3

The expanded CD8+CD57+T lymphocytes have a distinct immunophenotype in posttransplant myeloma patients without overt phenotypic abnormalities. Histograms from 1 representative patient bone marrow aspirate demonstrate the gating strategy and the distinct immunophenotype of CD3+, CD8+-gated cells identified in transplant patients. Cells were gated as CD3+ based on a CD3 and side-scattered dot plot, and the CD3+-gated cells were then gated as CD8+. These cells are partial CD57+, CD16-, negative to dim CD56, granzyme B-, and TIA-1 +. This immunophenotype was present in 19 of 20 patients 45 to 90 days after transplant.

Expanded LGL Population Persists in the Bone Marrow for Extended Periods

The finding of a large granular lymphocytosis following autologous stem cell transplant raises the question as to whether the lymphocytosis remains for extended periods. In this study, bone marrow and peripheral blood samples from 7 patients were obtained 6 months to 4 years past the autologous stem cell transplant. Surprisingly, flow cytometric immu nophenotyping of the bone marrow aspirates demonstrated a significant, persistent elevation in the relative percentage of CD8+ cells in transplant patients (55%) as compared with controls (38%) Figure 4A. Within the CD8+ cells, the CD57+ cells also remained increased (37%) (Figure 4A). Although the proportion of CD8+ T cells in the longer term post-autologous stem cell transplant patients was lower than in the immediate posttransplant period, the difference from controls is still significant. Surprisingly, these changes were even noted in the bone marrow aspirate collected 4 years after transplant. Morphologic evaluation of the peripheral blood with manual cell counts did not demonstrate an increased frequency of LGLs Figure 4B. Although flow cytometric analysis was not performed on the peripheral blood, these findings suggest the LGL population expands initially into the peripheral blood but subsequently remains expanded only in the bone marrow niche.

Figure 4

The unique cytotoxic T-cell population persists in the bone marrow beyond 2 months posttransplantation. Seven patient samples were collected ranging from 6 months to 4 years following autologous stem cell transplant. Flow cytometric immunophenotypic evaluation of the bone marrow aspirates was performed and reported as percent CD8+ T cells (A) and percent of CD8+ cells that were CD57+ (B) in transplant patients and controls. C, Manual cell counting of the lymphocytes was performed on the peripheral blood smears as in Image 1 and presented as percent large granular lymphocytes (LGLs) out of total lymphocytes. The error bars represent standard deviation.

Post-Autologous Stem Cell Transplant Myeloma Patients Positive for TCR Gene Rearrangement in the Bone Marrow

The other important question that arises in the presence of a large granular lymphocytosis is whether there is a clonal T-cell expansion. To address this question, we took 2 approaches. We analyzed all cases by flow cytometric immunophenotyping for restriction of KIRs (CD158a, CD158b, and CD158e) on the CD8+ T cells. We also performed molecular analysis for the presence of a clonal TCR gene rearrangement using DNA isolated from unstained bone marrow aspirate smears. In almost all cases, no expression of KIRs was identified, and thus, no assessment for clonality could be made based on KIR expression. However, the KIR panel used for standard analysis of LGL populations examined only 3 members of that family. In the 1 posttransplant case in which a population of CD8+ T cells had dim to negative expression of CD5, the population of CD8+ T cells also demonstrated KIR CD158 restriction. Molecular analysis for TCR gene rearrangement, however, identified that 65% of the transplant cases were positive for a clonal TCR gene rearrangement Figure 5. Interestingly, in all groups of myeloma patients tested, including those who were newly diagnosed, 33% or more had a positive clonal TCR gene rearrangement in the bone marrow aspirate. These findings suggest the T-cell expansion is clonal, at least in some patients, and that clonal T-cell populations are present in myeloma patients regardless of therapy but are increased following autologous stem cell transplantation.

Figure 5

The majority of myeloma patients have a clonal T-cell receptor (TCR) gene rearrangement in the bone marrow aspirate following autologous stem cell transplant. DNA was obtained from unfixed bone marrow aspirate smears from newly diagnosed myeloma patients, myeloma patients who had not undergone autologous stem cell transplant, myeloma patients 45 to 90 days after autologous stem cell transplant, and myeloma patients 6 months to 4 years after stem cell transplant. A, TCR gene rearrangement studies were performed to assess for clonality on the 4 different groups, and the results are displayed as the percentage of patients positive for clonal TCR gene rearrangement. B, A representative TCR clonality assessment tracing demonstrates a peak indicative of a monoclonal TCR gene rearrangement. The highest peak on the tracing has a reading of 3,438, which is more than 3 times greater than the third highest peak (218) within that defined range of DNA size. The next highest peak on the tracing has a reading of 621, which is not more than 3 times greater than the third highest peak in that defined DNA fragment size range (210). No peaks were identified in the other tube of this patient’s TCR analysis. These findings suggest there is 1 monoclonal peak present in this TCR analysis.

No Apparent Clinical Implications of LGL Expansion in Post-Autologous Stem Cell Transplant Myeloma Patients

To address the potential clinical effect of the LGL expansion following autologous bone marrow transplant, we reviewed the clinical records of the transplant patients to evaluate for hematopoietic reconstitution, infection, and transplant outcome. The findings are summarized in Table 1. Because of the unexpected finding that the LGL expansion was present in all post-autologous stem cell transplant patients in our study, no clear evaluation could be made as to the potential positive or negative effects of the presence of the expansion. All patients reconstituted the 3 hematopoietic lineages at approximately the same rate. The number of infections and clinical response to autologous transplant did not appear to correlate with the degree of the LGL expansion, although a larger number of patients would be necessary for thorough evaluation. Importantly, given the presence of a large granular lymphocytosis with a TCR clone, there was no evidence of persistent neutropenia, delayed myeloid reconstitution, or splenomegaly in any patients. The 1 patient with a KIR-restricted population of T cells with an abnormal phenotype did not have persistent neutropenia or an altered course at the time of transplant or at follow-up.

View this table:
Table 1

Discussion

The critical diagnostic decision in evaluating LGL expansions in a patient is determining whether the expansion is neoplastic or reactive. T-cell LGL (T-LGL) leukemia is a persistent clonal expansion of LGLs often with associated cyto-penias and autoimmune manifestations.12,13 LGL expansions also occur in reactive settings but typically with few clinical manifestations and no requirement for therapy.14 Expansions of T-LGLs have been reported following autologous and allogeneic stem cell transplants and solid organ transplants.24,15,16 Whether these expansions represent true posttransplant neoplastic processes, clonally restricted immune responses, or a spectrum of both is not clear. To evaluate the expansion of LGLs following autologous bone marrow transplant, we studied the LGL population in the bone marrow aspirates of myeloma patients at the first bone marrow biopsy after autologous transplant. In all 20 myeloma patients evaluated immediately following autologous transplant, an expansion of CD 8+ T cells with a distinct immunophenotype of partial CD57+, CD 16-, dim to negative CD56, and TIA-1+ was identified in the bone marrow. Molecular studies demonstrated the presence of a clonal TCR gene rearrangement in the majority of these patients. In addition, morphologic evaluation of the peripheral blood smears identified an increase in the absolute and relative number of LGLs. No patients in this study had associated clinical features of LGL leukemia such as cytope-nias or autoimmune manifestations. Together, these findings suggest that the expansion identified in the posttransplant patients in our study is a reactive response to the autologous transplant regimen.

Previous studies of LGL expansions following stem cell transplants have had mixed findings on the malignant or reactive nature of the expansions.13 As the methodology of identifying TCR clones has changed and improved with time, it is with caution that direct comparisons be made between our current clonality findings and those in previous studies. One series of LGL expansions following allogeneic stem cell transplants identified an expansion of CD8+CD57+ T cells in 6 of 201 patients following allogeneic stem cell transplants.3 Clonal TCRs were not identified in this series, and interestingly, 2 of the 6 patients had prior autologous stem cell transplants. In some patients, there were cytopenias, but the LGL expansions also were associated with an improved prognosis and did not require therapy. In comparison, the relative frequency of LGL expansion following autologous transplant in our study is higher than reported for allogeneic transplants, and many of the T-cell expansions in our study were clonal. As was found with the post-allogeneic transplant patients, the patients in the current study also did not require therapy. It was suggested in the allogeneic transplant series that the cytotoxic T cells were expanding in response to the foreign antigen exposure of the allogeneic transplant.3 In our study, we identified a similar population expansion in the autologous transplant setting where foreign hematopoietic cell antigen exposure was not occurring, suggesting there is another mechanism as the driving force of the T-LGL expansion.

Although almost all of the studies in the literature identify an expansion of CD8+CD57+ cells after transplant that is indolent and does not require therapy, 1 study identified a donor-derived clonal T-LGL leukemia arising after allogeneic stem cell transplant that progressively expanded with a fatal course.1 The patient in that study had concomitant graft vs host disease complicating the clinical picture, but the progressive course of the LGL expansion in that patient suggests it may have been more of a neoplastic lymphoproliferative process than the LGL expansions seen in the majority of post-transplant patients.

T-LGL expansions following autologous stem cell transplants have not been as thoroughly investigated as the expansions following allogeneic transplants, but case reports have described T-LGL leukemia following autologous stem cell transplant for myeloma and other hematopoietic malignancies.5,7,8 These LGL expansions have been defined in 2 of the cases5,8 as neoplastic processes because of their clonal nature, but the expansions were indolent, were not associated with cytopenias, and did not require therapy. The T cells had a similar phenotype to the T-cell expansions in our study and may represent a similar process.

Interestingly, LGL expansions have also been reported in solid organ transplants.4 Similar to the LGL expansion in our study following autologous stem cell transplant, a significant proportion of heart and renal transplant patients developed a clonal T-LGL expansion. None of the patients in that study developed neutropenia or had active donor organ rejection, and most patients did not receive therapy for the T-LGL expansion. In the setting of solid organ transplant, as with the allogeneic stem cell transplants, there is a constant allogeneic antigen stimulus that is not present in the autologous transplant setting. This discrepancy makes it difficult to determine if the T-LGLs identified in the current study are similar to the cells clonally expanding in the setting of solid organ transplant.

A fundamental challenge of curing malignancies of the immune system, such as multiple myeloma, is to simultaneously destroy clonally expanding malignant cells while preserving and driving immune cells that will fight the tumor and protect from infection. Previous studies have identified clonal expansions of CD8+ T cells in the peripheral blood of patients with MGUS and myeloma.17,18 The presence of clonal T cells in the blood in the prior studies correlated with a lower myeloma tumor burden.18,19 Clonal T cells also have been identified in other B-cell malignancies.20,21 In our study, we have defined a distinct cytotoxic CD8+CD57+ clonal T-cell expansion in the bone marrow occurring in the setting following autologous transplant. The phenotype of this population is strikingly similar to the population described in the peripheral blood of MGUS and myeloma patients.18,19 It is possible that the population identified in our study is an expansion of an already existing clonal cytotoxic tumor-specific T-cell population in myeloma patients that is allowed or driven to expand under the conditions of autologous transplant. As all of the myeloma patients evaluated after transplant in our study had an identifiable expansion of this distinct population of T-LGLs, it was not possible to determine if this expansion was of benefit or detriment to the patients. A larger cohort of patients is necessary to determine if the degree of T-LGL expansion has clinical implications or if this population is comparable to the clonal T-cell expansion in the prior studies.

This expanding T-LGL population in post-autologous transplant myeloma patients may be responding to the myeloma tumor cells or may represent a response to infectious agents,6 response to the chemokine milieu, or an autoimmune response. We identified a clear expansion of the LGL cells in the peripheral blood as well as bone marrow, but studies to determine the functionality of the T-LGLs are necessary to gain insight into the potential role of these cells in myeloma patients. Viral titers (such as Epstein-Barr virus) performed on the patients prior to and following the transplant may also help identify a potential viral reactivation as a driving force behind the LGL expansion. The designation of leukemia suggests a neoplastic process, but the findings in this study clearly demonstrate that an LGL expansion occurs frequently in the setting of autologous stem cell transplant in myeloma patients. The finding of this expansion of the T-LGL population with a distinct immunophenotype in every patient in our study following transplant strongly suggests it is a reactive process rather than a neoplastic process. The expanded population of LGLs in these patients has characteristics used to diagnose T-LGL leukemia,13 including an absolute LGL count in peripheral blood greater than 200/μL, clonal TCR gene rearrangements, and the persistence of the population in the bone marrow for years. Despite these findings, no clinical findings such as splenomegaly or persistent neutropenia were identified in any patient in the study. The lack of pathologic clinical sequelae of the LGL expansion supports that this T-LGL expansion is a reactive process.

The uniformity and distinct immunophenotype of the T-LGL expansion in myeloma patients following autologous transplant was unexpected. In addition, the high frequency of clonal TCR gene rearrangement studies in the bone marrows of myeloma patients with and without transplant was also unexpected. As the clonal TCR gene rearrangement studies are frequently used to identify a T-cell neoplasm, these studies may not be informative in myeloma. We propose that the T-LGL expansion identified after autologous transplant in myeloma patients is not an indolent LGL leukemia but rather a frequently occurring reactive response to autologous transplant. The cause and function of this expansion are unclear, but further studies may provide insight into the role of the immune system in myeloma transplant and therapy.

Acknowledgments

The authors thank Dave Dittman, Jennifer Sealise, and Laura Marszalek for their technical skills and contributions to this work.

Footnotes

  • This study was supported by an F32 Ruth L. Kirschstein National Research Service Award (NRSA) and an endowment from the Coleman Foundation, Chicago, IL.

References

View Abstract